دانلود پایان نامه

3- پرایمرها باید از نظر مکمل بودن با هم کنترل شوند. (پرایمر دایمر یا آغازگر دوتایی یک تکثیر مصنوعی است که اغلب در محصول PCR مشاهده می شود و عبارتست از یک قطعه دو رشته ای که طول آن تقریبا به مجموع دو پرایمر نزدیک است و هنگامی مشاهده می شود که یک پرایمر توسط آنزیم پلیمراز به روی پرایمر دیگر گسترش یابد. مکانیزم واقعی که چگونه پرایمر دایمر تشکیل می شود بدرستی مشخص نیست. پرایمرها با انتهای مکمل َ3 مستعد تشکیل دایمر هستند. ممکن است ضعف در آنزیم Taq باعث پلیمریزاسیون مستقیم الگوی غیرهدف شود. در هر حال چنانچه پرایمر دایمر بعنوان مانعی مشاهده شوند می توان آن را تا حدودی با غلظت حداقل پرایمر و آنزیم کاهش داد).
4- در انتهای َ3 پرایمر باید حداقل یک C یا G قرار گیرد در توالی هایی که پرایمرهای آنها دارای انتهای َ3 فاقد G یا C است، احتمال اتصال اشتباهی افزایش می یابد و به همین علت در پرایمرهای هدف ما هر دو به G و C ختم شدهاند.
5- باید تا حد امکان از توالی های پالیندرومیک داخل پرایمرها جلوگیری کرد زیرا سبب ایجاد ساختار Loop و Hairpin میگردد. پس از چک کردن این مشخصه توسط نرمافزار Gene Runner مشخص گردید که Hairpin و Internal Loop در ساختار پرایمرها وجود ندارد و فقط احتمال رخداد Dimer با 4 نوکلئوتید داخلی در دمای Cᵒ 79 وجود دارد که مشکل خاصی نیست.
6- نسبت چهار نوکلئوتید در پرایمر حتی المقدور یکسان باشد.
7- پرایمر به توالی تکرار شونده ختم نشود.
8- دمای ذوب دو پرایمر نزدیک هم باشد. (حد مجاز دمای اتصال پرایمر طراحی شده باید بین 65-55 باشد. دمای تکثیرایده آل 72-62 می باشد). در مورد پرایمرهای هدف ما، دمای ذوب پرایمر مستقیم و معکوس به ترتیب Cᵒ 3/47 و Cᵒ 1/47 بدست آمد.
9- درجه حرارتی که پرایمر به DNA الگو متصل می شود به طول آغازگر و مقدار GC آن بستگی دارد برای پرایمرهای حاوی GC 50% و دارای 20 نوکلئوتید، دمای 55 درجه سانتیگراد پیشنهاد می شود، برای افزایش اختصاصی عمل کردن آغازگر حتی ممکن است دماهای بالاتری هم مورد نیاز باشد. در مورد پرایمر مد نظر ما، به علت وجود محتوای GC 45%، توسط شرکت سازنده دمای 55 درجه پیشنهاد شد که به علت تشکیل باندهای غیر اختصاصی و انجام PCR Gradiant دمای Cᵒ61 بهترین دما ارزیابی شد.
غلظت پرایمرها و روش اندازه گیری آن
غلظت پرایمر بین 50/0 تا 5/0 میکرومول و حد مطلوب 6/0 – 1/0 برای یک واکنش 25 میکرولیتری می باشد. غلظت بالای پرایمر باعث بسط غیراختصاصی و پرایمر دایمر می شود. در مطالعه حاضر، غلظت pmol/ml10 بهترین غلظت ارزیابی گردید.
بسط پرایمر
مدت زمان بسط بستگی به طول توالی هدف، غلظت توالی هدف و دمای تکثیر دارد. بسط پرایمر بطورمعمول در دمای 72 درجه سانتیگراد ظرف مدت 45- 30 ثانیه انجام می شود (این زمان برای فرآورده های معادل 2 کیلو باز کافیست).
پرایمرهای طراحی شده در تیوب اولیه در غلظت 100 پیکومول به عنوان ذخیره اصلی Stock Solution در 20- سانتی گراد نگهداری شد و محلول مورد استفاده پرایمرهای با غلظت 10 پیکومولار از آن ها تهیه شد.
طراحی پرایمر با نرم افزار
جهت طراحی پرایمر در ابتدا از سایت NCBI و نرم افزار تحت وب Primer Blast استفاده گردید. نتایج چندان مطلوب نبود به همین دلیل با استفاده از نرم افزار Gene Runner استفاده شد که مجدداً با توجه به حجم بالای تکرارها و وجود توالی AT فراوان در ساختار ژن مدنظر، در نهایت طراحی پرایمر به صورت دستی انجام پذیرفت.
به منظور اطمینان از صحت و عملکرد پرایمرهای طراحی شده، یک نوبت توسط نرم افزار Gene Runner و یک نوبت توسط نرم افزار تحت وب Primer Blast از نظر Tm، Hairpin Loop، Dimers و Internal Loop مورد ارزیابی قرار گرفت. (‏شکل (3-2) )
پرایمر
توالی 5َ به 3َ
Forward
ATTAAGCTGGTATGAGGTCC
Reverse
AAGAGGAGGTGAGTTTATGG
طراحی پرایمر با نرمافزار